Skip to main content

PRK5-FLAG-Bag6ΔUBL
(Plasmid #61837)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61837 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRK5
  • Backbone size w/o insert (bp) 5204
  • Total vector size (bp) 8325
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bag6
  • Alt name
    BCL2-associated athanogene 6
  • Alt name
    G3; BAT3; BAG-6; D6S52E
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3138
  • GenBank ID
    protein reference sequence P46379-1.
  • Entrez Gene
    BAG6 (a.k.a. BAG-6, BAT3, D6S52E, G3)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CTCTAGCATTTAGGTGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PRK5-FLAG-Bag6ΔUBL was a gift from Yihong Ye (Addgene plasmid # 61837 ; http://n2t.net/addgene:61837 ; RRID:Addgene_61837)
  • For your References section:

    USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Liu Y, Soetandyo N, Lee JG, Liu L, Xu Y, Clemons WM Jr, Ye Y. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. 10.7554/eLife.01369 PubMed 24424410