-
PurposeExpresses HER2/neu receptor specific humanized IgG1/κ antibody isotype (Trastuzumab-IgG1/κ)
-
Depositing Lab
-
Sequence Information
-
Sequences (6) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepVITRO1-hygro-mcs
-
Backbone manufacturerInvivoGen
- Backbone size w/o insert (bp) 6491
- Total vector size (bp) 8583
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameHER2/neu receptor specific humanized Gamma 1 heavy chain expression cassette
-
Alt nameTrastuzumab-IgG1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1410
- Promoter mEF1 Prom
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTTTGAGCGGAGCTAATTCTCGGG
- 3′ sequencing primer AAAAAACCTCCCACACCTCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHER2/neu receptor specific humanized kappa light chain expression cassette
-
Alt nameTrastuzumab-IgK
-
SpeciesH. sapiens (human)
-
Insert Size (bp)702
- Promoter rEF1 Prom
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAGGCTAATTCTCAAGCCTC
- 3′ sequencing primer TCTAGACCTGGAAAGACCAG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVITRO1-Trastuzumab-IgG1/κ was a gift from Andrew Beavil (Addgene plasmid # 61883 ; http://n2t.net/addgene:61883 ; RRID:Addgene_61883) -
For your References section:
A tool kit for rapid cloning and expression of recombinant antibodies. Dodev TS, Karagiannis P, Gilbert AE, Josephs DH, Bowen H, James LK, Bax HJ, Beavil R, Pang MO, Gould HJ, Karagiannis SN, Beavil AJ. Sci Rep. 2014 Jul 30;4:5885. doi: 10.1038/srep05885. 10.1038/srep05885 PubMed 25073855