Skip to main content

pVITRO1-Trastuzumab-IgG4/κ
(Plasmid #61887)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61887 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pVITRO1-hygro-mcs
  • Backbone manufacturer
    InvivoGen
  • Backbone size w/o insert (bp) 6491
  • Total vector size (bp) 8574
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    HER2/neu receptor specific humanized Gamma 4 heavy chain expression cassette
  • Alt name
    Trastuzumab-IgG4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1401
  • Promoter mEF1 Prom

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTTTGAGCGGAGCTAATTCTCGGG
  • 3′ sequencing primer AAAAAACCTCCCACACCTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    HER2/neu receptor specific humanized kappa light chain expression cassette
  • Alt name
    Trastuzumab-IgK
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    702
  • Promoter rEF1 Prom

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GAGGCTAATTCTCAAGCCTC
  • 3′ sequencing primer TCTAGACCTGGAAAGACCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVITRO1-Trastuzumab-IgG4/κ was a gift from Andrew Beavil (Addgene plasmid # 61887 ; http://n2t.net/addgene:61887 ; RRID:Addgene_61887)
  • For your References section:

    A tool kit for rapid cloning and expression of recombinant antibodies. Dodev TS, Karagiannis P, Gilbert AE, Josephs DH, Bowen H, James LK, Bax HJ, Beavil R, Pang MO, Gould HJ, Karagiannis SN, Beavil AJ. Sci Rep. 2014 Jul 30;4:5885. doi: 10.1038/srep05885. 10.1038/srep05885 PubMed 25073855