Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #62191)


Item Catalog # Description Quantity Price (USD)
Plasmid 62191 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    humanized S. Pyogenes Cas9
  • Alt name
  • Alt name
  • Alt name
  • Species
    S. Pyogenes
  • Insert Size (bp)
  • Promoter TRE3G
  • Tag / Fusion Protein
    • 3x FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TCTGCGACTCTAGAGGATCA
  • 3′ sequencing primer CACCCTGAAAACTTTGCCCC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    c3GIC9 was a gift from Lukas Dow (Addgene plasmid # 62191 ; ; RRID:Addgene_62191)
  • For your References section:

    Inducible in vivo genome editing with CRISPR-Cas9. Dow LE, Fisher J, O'Rourke KP, Muley A, Kastenhuber ER, Livshits G, Tschaharganeh DF, Socci ND, Lowe SW. Nat Biotechnol. 2015 Apr;33(4):390-4. doi: 10.1038/nbt.3155. Epub 2015 Feb 18. 10.1038/nbt.3155 PubMed 25690852