-
Purposecol1a1 targeting vector for inducible [TRE3G]-GFP-IRES-Cas9n (D10A variant) expression. Contains NsiI cloning site for U6-sgRNA cassettes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62192 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonecol1a1 Flp-in targeting construct
- Total vector size (bp) 10668
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehumanized S. Pyogenes Cas9 (D10A)
-
Alt nameSpCas9n
-
Alt namehSpCas9n
-
Alt namehCas9n
-
SpeciesS. Pyogenes
-
Insert Size (bp)4164
-
MutationD10A substitution (Cas9n)
- Promoter TRE3G
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TCTGCGACTCTAGAGGATCA
- 3′ sequencing primer CACCCTGAAAACTTTGCCCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhCas9n was cloned from PX335
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
c3GIC9n was a gift from Lukas Dow (Addgene plasmid # 62192 ; http://n2t.net/addgene:62192 ; RRID:Addgene_62192) -
For your References section:
Inducible in vivo genome editing with CRISPR-Cas9. Dow LE, Fisher J, O'Rourke KP, Muley A, Kastenhuber ER, Livshits G, Tschaharganeh DF, Socci ND, Lowe SW. Nat Biotechnol. 2015 Apr;33(4):390-4. doi: 10.1038/nbt.3155. Epub 2015 Feb 18. 10.1038/nbt.3155 PubMed 25690852