pcDNA3.1-CHRFAM7A
(Plasmid
#62284)
-
Purposemammalian expression of human duplicated Alpha7 (CHRFAM7A)
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62284 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 8000
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCHRFAM7A
-
Alt namedhAlpha7
-
Alt nameHuman Alpha7 neuronal nicotinic acetylcholine receptor gene with partial duplication
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1638
-
Mutationpartial duplication of CHRNA7
-
GenBank ID89832 NM_139320.1
-
Entrez GeneCHRFAM7A (a.k.a. CHRNA7, CHRNA7-DR1, D-10, NACHRA7)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTCGGTGCCCCTTGCCATTT
- 3′ sequencing primer CCTTGCCCATCTGTGAGTTTTCCAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. Sherry Leonard Department of Psychiatry, University of Colorado, Denver, CO 80045
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-CHRFAM7A was a gift from Sherry Leonard & Henry Lester (Addgene plasmid # 62284 ; http://n2t.net/addgene:62284 ; RRID:Addgene_62284) -
For your References section:
The duplicated alpha7 subunits assemble and form functional nicotinic receptors with the full-length alpha7. Wang Y, Xiao C, Indersmitten T, Freedman R, Leonard S, Lester HA. J Biol Chem. 2014 Sep 19;289(38):26451-63. doi: 10.1074/jbc.M114.582858. Epub 2014 Jul 23. 10.1074/jbc.M114.582858 PubMed 25056953