pBabe-ER-E2F2-dRb
(Plasmid
#62805)
-
Purposeexpresses an inducible E2F2 mutant that lacks the Rb binding domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62805 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBabe
- Backbone size w/o insert (bp) 5200
- Total vector size (bp) 7066
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE2F2
-
Alt nameE2F transcription factor 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)900
-
Mutationdeletion of amino acids 302-437, including the Rb binding domain
-
GenBank ID
-
Entrez GeneE2F2 (a.k.a. E2F-2)
-
Tag
/ Fusion Protein
- HA-Er (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer ctttatccagccctcac
- 3′ sequencing primer ggaatgtgtgtcagttagggt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr K. Helin. Department of Experimental Oncology, European Institute of Oncology, 20141 Milan, Italy
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pBABE-ER-E2Fs were
gifts from Dr. K. Helin
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBabe-ER-E2F2-dRb was a gift from Gerardo Ferbeyre (Addgene plasmid # 62805 ; http://n2t.net/addgene:62805 ; RRID:Addgene_62805) -
For your References section:
Regulation of E2Fs and senescence by PML nuclear bodies. Vernier M, Bourdeau V, Gaumont-Leclerc MF, Moiseeva O, Begin V, Saad F, Mes-Masson AM, Ferbeyre G. Genes Dev. 2011 Jan 1;25(1):41-50. doi: 10.1101/gad.1975111. 10.1101/gad.1975111 PubMed 21205865