Skip to main content

pGoldyTALEN-VIM-TAL-2
(Plasmid #62852)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62852 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBSK
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5563
  • Vector type
    Mammalian Expression, TALEN

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALEN array
  • Species
    Synthetic
  • Insert Size (bp)
    1740
  • Promoter miniCAGG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer catcgcgcaatgcactgac
  • 3′ sequencing primer attcagatttcactagctgggatc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pCGS652 from the Voytas lab was used for Golden Gate assembly.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGoldyTALEN-VIM-TAL-2 was a gift from Gaudenz Danuser (Addgene plasmid # 62852 ; http://n2t.net/addgene:62852 ; RRID:Addgene_62852)
  • For your References section:

    Vimentin Intermediate Filaments Template Microtubule Networks to Enhance Persistence in Cell Polarity and Directed Migration. Gan Z, Ding L, Burckhardt CJ, Lowery J, Zaritsky A, Sitterley K, Mota A, Costigliola N, Starker CG, Voytas DF, Tytell J, Goldman RD, Danuser G. Cell Syst. 2016 Sep 21. pii: S2405-4712(16)30262-9. doi: 10.1016/j.cels.2016.08.007. 10.1016/j.cels.2016.08.007 PubMed 27667364