-
PurposeC-term SpCas9 piece of inducible transcriptional activator (dCas9(C)-FKBP-2xNLS-VP64)
-
Depositing Lab
-
Depositing OrganizationBroad Institute
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62888 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 62888-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 62888-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePX330
-
Backbone manufacturerZhang lab
- Backbone size w/o insert (bp) 4222
- Total vector size (bp) 7351
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9 (aa536-1368)
-
Insert Size (bp)3129
-
MutationAsparagine 863 to Alanine (N863A)
- Promoter CBh
-
Tags
/ Fusion Proteins
- NLS SV40 (N terminal on insert)
- FKBP12 (N terminal on insert)
- NLS (C terminal on insert)
- VP64 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer ctggagcacctgcctgaaatcact
- 3′ sequencing primer GGCTGATCAGCGAGCTCTAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySpCas9 piece was PCR amplified of PX429
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 62888-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 62888-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX856 was a gift from Feng Zhang (Addgene plasmid # 62888 ; http://n2t.net/addgene:62888 ; RRID:Addgene_62888) -
For your References section:
A split-Cas9 architecture for inducible genome editing and transcription modulation. Zetsche B, Volz SE, Zhang F. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. 10.1038/nbt.3149 PubMed 25643054