Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #62887)


Item Catalog # Description Quantity Price (USD)
Plasmid 62887 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Zhang lab
  • Backbone size w/o insert (bp) 4222
  • Total vector size (bp) 6205
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    SpCas9 (aa 2-535)
  • Insert Size (bp)
  • Mutation
    Aspartic acide 10 to Alanine (D10A)
  • Promoter CBh
  • Tags / Fusion Proteins
    • NES PTK2 (N terminal on insert)
    • FRB (C terminal on insert)
    • NES PTK2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer ctggagcacctgcctgaaatcact
  • 3′ sequencing primer GGCTGATCAGCGAGCTCTAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    SpCas9 piece was PCR amplified of PX481 (dCas9)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX855 was a gift from Feng Zhang (Addgene plasmid # 62887 ; ; RRID:Addgene_62887)
  • For your References section:

    A split-Cas9 architecture for inducible genome editing and transcription modulation. Zetsche B, Volz SE, Zhang F. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. 10.1038/nbt.3149 PubMed 25643054