Skip to main content

pJEP212-Lenti-1.3CaMKII-P-Intron-MCS-WPRE-pA
(Plasmid #62931)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62931 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti7.3DEST
  • Backbone manufacturer
    Invitrogen
  • Backbone size (bp) 8153
  • Modifications to backbone
    Modified the backbone by removing the emGFP expression cassette and adding a multiple cloning site (MCS)
  • Vector type
    Lentiviral
  • Promoter 1.3αCaMKII

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer aaaggtacctcgtaacattatggccttaggtcacttcatctccatggggttc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJEP212-Lenti-1.3CaMKII-P-Intron-MCS-WPRE-pA was a gift from Jonathan Ploski (Addgene plasmid # 62931 ; http://n2t.net/addgene:62931 ; RRID:Addgene_62931)
  • For your References section:

    The production of viral vectors designed to express large and difficult to express transgenes within neurons. Holehonnur R, Lella SK, Ho A, Luong JA, Ploski JE. Mol Brain. 2015 Feb 24;8:12. doi: 10.1186/s13041-015-0100-7. 10.1186/s13041-015-0100-7 PubMed 25887710