VARP GFP-pLXIN
(Plasmid
#62950)
-
Purposefull length human VARP with C-terminal EGFP tag cloned into pLXIN
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62950 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLXIN
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6100
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVARP
-
Alt nameankyrin repeat domain 27 (VPS9 domain)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3902
-
Mutationsilent mutations of amino acids 422-428 to produce construct resistant to siRNA oligoVARP1
-
GenBank IDNM_032139.2
-
Entrez GeneANKRD27 (a.k.a. PP12899, VARP)
- Promoter LTR
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer 5’ GTACACCCTAAGCCTCCGCC 3’
- 3′ sequencing primer 5’ CCCTCACATTGCCAAAAGAC 3’ (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
DNA sequences of amino acids 422-428:
WT CATGATAAAGATACCGTCCAA
Mutant CACGACAAGGACACTGTACAG
siRNA oligo is Dharmacon On-Target Plus oligonucleotide ANKRD27 siRNA. Catalogue number was as follows: (J‐01478809).
In Hesketh et al. (2014) Dev Cell. 29: 591-606 it is called VARP1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VARP GFP-pLXIN was a gift from Paul Luzio (Addgene plasmid # 62950 ; http://n2t.net/addgene:62950 ; RRID:Addgene_62950) -
For your References section:
VARP is recruited on to endosomes by direct interaction with retromer, where together they function in export to the cell surface. Hesketh GG, Perez-Dorado I, Jackson LP, Wartosch L, Schafer IB, Gray SR, McCoy AJ, Zeldin OB, Garman EF, Harbour ME, Evans PR, Seaman MN, Luzio JP, Owen DJ. Dev Cell. 2014 Jun 9;29(5):591-606. doi: 10.1016/j.devcel.2014.04.010. Epub 2014 May 22. 10.1016/j.devcel.2014.04.010 PubMed 24856514