Skip to main content

lgp120+linker-pEGFP N1
(Plasmid #62963)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62963 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lgp120
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1281
  • Mutation
    has 2 amino acid mutations compared to the coding sequence of NM_012857.2 D50E N371Y
  • GenBank ID
    NM_012857.2
  • Entrez Gene
    Lamp1 (a.k.a. LGP120)
  • Promoter CMV
  • Tags / Fusion Proteins
    • linker (C terminal on insert)
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer 5’ CCAAAATCAACGGGACTTTCC 3’
  • 3′ sequencing primer 5’ CAGCTTGCCGTAGGTGGC 3’
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The 10 amino acid linker was designed using the sequence as described below but with different cloning sites (EcoRI and BamHI):
Patterson GH and Lippincott-Schwartz J. (2002) A Photoactivatable GFP for Selective Photolabeling of Proteins and Cells. Science 297, 1873-1877.

Examples of use:

Jahreiss L, Menzies FM, Rubinsztein DC. (2008) The itinerary of autophagosomes: from peripheral formation to kiss-and-run fusion with lysosomes. Traffic 9: 574-587.

Renna M, Schaffner C, Winslow AR, Menzies FM, Peden AA, Floto RA, Rubinsztein DC. (2011) Autophagic substrate clearance requires activity of the syntaxin-5 SNARE complex. J Cell Sci 124:469-482.

Ogunbayo OA, Zhu Y, Shen B, Agban E, Li J, Ma J, Zhu MX, Evans AM. (2015) Organelle-specific Subunit Interactions of the Vertebrate Two-pore Channel Family. J. Biol. Chem. 290: 1086-1095.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lgp120+linker-pEGFP N1 was a gift from Paul Luzio (Addgene plasmid # 62963 ; http://n2t.net/addgene:62963 ; RRID:Addgene_62963)