pJEP210-AAV-0.4CaMKII P-MCS-pA
(Plasmid
#63084)
-
Purpose(Empty Backbone) AAV2 vector backbone containing a 0.4CaMKIIa promoter followed by a multiple cloning site(MCS) followed by a poly-Adenylation Signal (pA)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63084 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
-
Backbone manufacturerVector Biolabs
- Backbone size (bp) 3654
-
Modifications to backboneVector backbone has 219 bps 3’UTR that contains an SV40 based poly-adenylation signal
-
Vector typeAAV
- Promoter 0.4αCaMKII
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer AAAACGCGTACTTGTGGACTAAGTTTGTTCACATCCCCTTCTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEP210-AAV-0.4CaMKII P-MCS-pA was a gift from Jonathan Ploski (Addgene plasmid # 63084 ; http://n2t.net/addgene:63084 ; RRID:Addgene_63084) -
For your References section:
The production of viral vectors designed to express large and difficult to express transgenes within neurons. Holehonnur R, Lella SK, Ho A, Luong JA, Ploski JE. Mol Brain. 2015 Feb 24;8:12. doi: 10.1186/s13041-015-0100-7. 10.1186/s13041-015-0100-7 PubMed 25887710