Skip to main content

pDual-eGFP(Y203)
(Plasmid #63559)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63559 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDual-eGFP
  • Backbone size w/o insert (bp) 10680
  • Total vector size (bp) 10947
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    eGFP is strongly expressed in the Rosetta-gami™2(DE3) strain (EMD Millipore) following IPTG induction of the T7 RNA polymerase gene.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    His-T7-eGFP(Y203)
  • Alt name
    His-tagged, T7-tagged Mostaza (yellow) variant of enhanced green fluorescent protein
  • Species
    Synthetic
  • Insert Size (bp)
    864
  • Mutation
    Changed threonine at position 203 with respect to the original eGFP sequence to tyrosine. The DNA sequence change corresponds to AC at nucleotide 727-728 to TA.
  • GenBank ID
    KM019175
  • Promoter CMV-EF1α hybrid (CEF)
  • Tags / Fusion Proteins
    • His6 (N terminal on insert)
    • T7 (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cgtcgccgtccagctcgaccag
  • 3′ sequencing primer gagcaagggcgaggagctgttc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Lentiviral vector with high transduction efficiency. Expression from the CMV-EF1α hybrid (CEF) promoter is very stable in mammalian cells. The lentivirus contains an SV40 origin 5’ to the eGFP gene. This influences gene targeting rates and the preferred strand for gene targeting and recombineering in cells expressing the SV40 T-antigen.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDual-eGFP(Y203) was a gift from Richard S Myers (Addgene plasmid # 63559 ; http://n2t.net/addgene:63559 ; RRID:Addgene_63559)
  • For your References section:

    Fluorescent protein engineering by in vivo site-directed mutagenesis. Valledor M, Hu Q, Schiller P, Myers RS. IUBMB Life. 2012 Aug;64(8):684-9. doi: 10.1002/iub.1041. Epub 2012 May 28. 10.1002/iub.1041 PubMed 22639380