Skip to main content
Addgene

pBa-eGFP-flag-BicD2 594-FKBP
(Plasmid #63569)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63569 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBa-eGFP-FKBP
  • Backbone size w/o insert (bp) 7041
  • Total vector size (bp) 8871
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bicaudal D protein
  • Alt name
    BicD2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1830
  • Mutation
    no start methionine, aa1-594
  • GenBank ID
    AJ250106
  • Entrez Gene
    Bicd2
  • Promoter chicken Beta Actin
  • Tags / Fusion Proteins
    • eGFP (N terminal on backbone)
    • flag (N terminal on insert)
    • FKBP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site RsrII (not destroyed)
  • 5′ sequencing primer CCAACGAGAAGCGCGATCACAT
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    bicaudal D2 mouse from ATCC
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBa-eGFP-flag-BicD2 594-FKBP was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 63569 ; http://n2t.net/addgene:63569 ; RRID:Addgene_63569)
  • For your References section:

    A novel assay reveals preferential binding between Rabs, kinesins, and specific endosomal subpopulations. Bentley M, Decker H, Luisi J, Banker G. J Cell Biol. 2015 Feb 2;208(3):273-281. Epub 2015 Jan 26. 10.1083/jcb.201408056 PubMed 25624392