pX330A_FokI-1x5
(Plasmid #63605)

• Purpose: Expresses FokI-dCas9 and gRNA
• Depositing Lab: Takashi Yamamoto
• Publication: Nakagawa et al BMC Biotechnol. 2015 May 22;15(1):33.

Backbone

• Vector backbone: pUC ori vector
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FokI-dCas9
• Species: S. pyogenes and F. okeanokoites
• Promoter: CBh

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: T7 (TAATACGACTCACTATAGGG)

Resource Information

• Supplemental Documents:
  • GenBank file
• A portion of this plasmid was derived from a plasmid made by: Feng Zhang

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry