Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AEB-DNT3
(Plasmid #63852)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 63852 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFTV1
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNT3 DNT riboswitch
  • Species
    Synthetic
  • Promoter AEB3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer RNAde-BB-3 (tacggacgaccttcaccttc)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AEB-DNT3 was a gift from Howard Salis (Addgene plasmid # 63852 ; http://n2t.net/addgene:63852 ; RRID:Addgene_63852)
  • For your References section:

    Automated physics-based design of synthetic riboswitches from diverse RNA aptamers. Espah Borujeni A, Mishler DM, Wang J, Huso W, Salis HM. Nucleic Acids Res. 2015 Nov 30. pii: gkv1289. 10.1093/nar/gkv1289 PubMed 26621913