MLS- mir-17-19b
(Plasmid
#64089)
-
Purposeexpresses a truncated version of mir-17-92 lacking miR-92
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV-SV40-GFP
- Backbone size w/o insert (bp) 6216
- Total vector size (bp) 6996
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemir-17-19b
-
SpeciesH. sapiens (human)
-
Insert Size (bp)780
-
Entrez GeneMIR17 (a.k.a. MIR17-5p, MIR91, MIRN17, MIRN91, hsa-mir-17, miR-17, miR17-3p, miRNA17, miRNA91)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer GCCCTCACTCCTTCTCTAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MLS- mir-17-19b was a gift from Lin He (Addgene plasmid # 64089 ; http://n2t.net/addgene:64089 ; RRID:Addgene_64089) -
For your References section:
miR-19 is a key oncogenic component of mir-17-92. Olive V, Bennett MJ, Walker JC, Ma C, Jiang I, Cordon-Cardo C, Li QJ, Lowe SW, Hannon GJ, He L. Genes Dev. 2009 Dec 15. 23(24):2839-49. 10.1101/gad.1861409 PubMed 20008935