Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

MLS-mir-17-92
(Plasmid #64090)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64090 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCV-SV40-GFP
  • Backbone size w/o insert (bp) 6216
  • Total vector size (bp) 7166
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    miR-17-92
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    950
  • Entrez Gene
    MIR17HG (a.k.a. C13orf25, FGLDS2, LINC00048, MIHG1, MIRH1, MIRHG1, NCRNA00048, miR-17-92)
  • Promoter MSCV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer GCCCTCACTCCTTCTCTAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MLS-mir-17-92 was a gift from Lin He (Addgene plasmid # 64090 ; http://n2t.net/addgene:64090 ; RRID:Addgene_64090)
  • For your References section:

    miR-19 is a key oncogenic component of mir-17-92. Olive V, Bennett MJ, Walker JC, Ma C, Jiang I, Cordon-Cardo C, Li QJ, Lowe SW, Hannon GJ, He L. Genes Dev. 2009 Dec 15. 23(24):2839-49. 10.1101/gad.1861409 PubMed 20008935