sgRNA1_NANOG
(Plasmid
#64153)
-
PurposePhotoactivatable transcription system. Lentiviral expression of NANOG sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepgRNA-humanized
-
Backbone manufacturerStanley Qi, Addgene plasmid 44248
- Total vector size (bp) 8309
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA1_NANOG
-
Alt nameNANOG
-
gRNA/shRNA sequenceTGGCGCCAGGAGGGGTGGGTCTA
-
SpeciesH. sapiens (human)
-
Entrez GeneNANOG
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstX1 (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AAGGAAACTCACCCTAACTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgRNA1_NANOG was a gift from Moritoshi Sato (Addgene plasmid # 64153 ; http://n2t.net/addgene:64153 ; RRID:Addgene_64153) -
For your References section:
CRISPR-Cas9-based Photoactivatable Transcription System. Nihongaki Y, Yamamoto S, Kawano F, Suzuki H, Sato M. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. 10.1016/j.chembiol.2014.12.011 PubMed 25619936