Skip to main content

sgRNA1_GAL4UAS-Luciferase reporter
(Plasmid #64157)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64157 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pgRNA-humanized
  • Backbone manufacturer
    Stanley Qi, Addgene plasmid 44248
  • Total vector size (bp) 8309
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA1 for GAL4UAS-Luciferase reporter
  • gRNA/shRNA sequence
    TGGGTCTTCGGAGGACAGTACTC
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstX1 (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AAGGAAACTCACCCTAACTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA1_GAL4UAS-Luciferase reporter was a gift from Moritoshi Sato (Addgene plasmid # 64157 ; http://n2t.net/addgene:64157 ; RRID:Addgene_64157)
  • For your References section:

    CRISPR-Cas9-based Photoactivatable Transcription System. Nihongaki Y, Yamamoto S, Kawano F, Suzuki H, Sato M. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. 10.1016/j.chembiol.2014.12.011 PubMed 25619936