pMSCV-PIG-miR-18a
(Plasmid
#64228)
-
PurposeExpresses miR-18a in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64228 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMSCV PIG
-
Backbone manufacturerScott Lowe
- Backbone size w/o insert (bp) 7658
- Total vector size (bp) 7871
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR-18a
-
SpeciesH. sapiens (human)
-
Insert Size (bp)208
-
GenBank IDNR_029488
-
Entrez GeneMIR18A (a.k.a. C13orf25, MIR17HG, MIR18, MIRH1, MIRHG1, MIRN18, MIRN18A, hsa-mir-18, hsa-mir-18a, miR-18, miRNA18A, mir-18a)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GATGTGGAATGTGTGCGAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-PIG-miR-18a was a gift from Joshua Mendell (Addgene plasmid # 64228 ; http://n2t.net/addgene:64228 ; RRID:Addgene_64228) -
For your References section:
Widespread microRNA repression by Myc contributes to tumorigenesis. Chang TC, Yu D, Lee YS, Wentzel EA, Arking DE, West KM, Dang CV, Thomas-Tikhonenko A, Mendell JT. Nat Genet. 2008 Jan;40(1):43-50. Epub 2007 Dec 9. 10.1038/ng.2007.30 PubMed 18066065