Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMSCV-PIG-miR-150
(Plasmid #64235)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64235 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSCV PIG
  • Backbone manufacturer
    Scott Lowe
  • Backbone size w/o insert (bp) 7658
  • Total vector size (bp) 8064
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR150
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    401
  • GenBank ID
    NR_029703
  • Entrez Gene
    MIR150 (a.k.a. MIRN150, miRNA150, mir-150)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GATGTGGAATGTGTGCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-PIG-miR-150 was a gift from Joshua Mendell (Addgene plasmid # 64235 ; http://n2t.net/addgene:64235 ; RRID:Addgene_64235)
  • For your References section:

    Widespread microRNA repression by Myc contributes to tumorigenesis. Chang TC, Yu D, Lee YS, Wentzel EA, Arking DE, West KM, Dang CV, Thomas-Tikhonenko A, Mendell JT. Nat Genet. 2008 Jan;40(1):43-50. Epub 2007 Dec 9. 10.1038/ng.2007.30 PubMed 18066065