Skip to main content
Addgene

pBa-FRB-3myc-KIF1B beta tail 387-1770
(Plasmid #64287)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64287 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBa-FRB
  • Backbone size w/o insert (bp) 6287
  • Total vector size (bp) 10569
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KIF1B beta
  • Alt name
    KIF1B v2
  • Species
    M. musculus (mouse), R. norvegicus (rat)
  • Insert Size (bp)
    4282
  • Mutation
    aa 387-1770, small portion of 5'end matches rat, 3'end matches mouse. V407A, L536I, S542N, Y939C, Q1093R, T1187I, K1691E, and S1766N relative to NM_207682
  • GenBank ID
    NM_207682
  • Entrez Gene
    Kif1b (a.k.a. A530096N05Rik, AI448212, AI506502, D4Mil, D4Mil1e, KIF1Bp1, KIF1Bp130, KIF1Bp2, KIF1Bp204)
  • Promoter chicken Beta Actin
  • Tags / Fusion Proteins
    • FRB (N terminal on backbone)
    • 3myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site BclI (not destroyed)
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBa-FRB-3myc-KIF1B beta tail 387-1770 was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 64287 ; http://n2t.net/addgene:64287 ; RRID:Addgene_64287)
  • For your References section:

    A novel assay reveals preferential binding between Rabs, kinesins, and specific endosomal subpopulations. Bentley M, Decker H, Luisi J, Banker G. J Cell Biol. 2015 Feb 2;208(3):273-281. Epub 2015 Jan 26. 10.1083/jcb.201408056 PubMed 25624392