Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #64325)


Item Catalog # Description Quantity Price (USD)
Plasmid 64325 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    p15A vector
  • Backbone size w/o insert (bp) 2598
  • Total vector size (bp) 6777
  • Vector type
    Bacterial Expression, CRISPR ; Tetracycline-inducible

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    Synthetic; S. pyogenes
  • Insert Size (bp)
  • Mutation
    D10A, H840A
  • Promoter pLtetO-1
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site Xho I (not destroyed)
  • 5′ sequencing primer cgattccgacctcattaagcagc
  • 3′ sequencing primer tgcctggagatccttactcgaGTTAGTCACCTCCTAGCTGACTCAAATCAAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    A portion of this plasmid was derived from a plasmid made by Stanley Qi (Addgene plasmid 44249)
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid

Depositor Comments

This plasmid is compatible with gRNA expression plasmids for E. coli, such as Addgene Plasmid #44251 ( ).

For more information on Fujii Lab CRISPR Plasmids please refer to:

Plasmid also described in Fujita, T. and Fujii, H., Biochem Biophys Res Commun. 2013 Sep 13;439(1):132-6. doi: 10.1016/j.bbrc.2013.08.013, PMID: 23942116

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xFLAG-dCas9/p-bacteria was a gift from Hodaka Fujii (Addgene plasmid # 64325 ; ; RRID:Addgene_64325)
  • For your References section:

    An enChIP system for the analysis of bacterial genome functions. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Jun 14;11(1):387. doi: 10.1186/s13104-018-3486-3. 10.1186/s13104-018-3486-3 PubMed 29898790