Skip to main content

pHAGE-TO-nls-st1dCas9-3nls-3XTagBFP2
(Plasmid #64512)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64512 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE-DEST
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 12293
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    St1 dCas9
  • Species
    Synthetic
  • Insert Size (bp)
    3357
  • Promoter CMV-TO
  • Tag / Fusion Protein
    • 3XmTagBFP2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cgaaggaatagaagaagaaggtgga
  • 3′ sequencing primer CCAAAGGGAGATCCGACTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE-TO-nls-st1dCas9-3nls-3XTagBFP2 was a gift from Thoru Pederson (Addgene plasmid # 64512 ; http://n2t.net/addgene:64512 ; RRID:Addgene_64512)
  • For your References section:

    Multicolor CRISPR labeling of chromosomal loci in human cells. Ma H, Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. 10.1073/pnas.1420024112 PubMed 25713381