pAAV-CMV-iRFP
(Plasmid
#64887)
-
PurposeMarking retinal neurons with infrared fluorescent proteins (iRFP) to preserve photoresponsiveness
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-CMV
-
Backbone manufacturerCell Biolabs
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiRFP
-
SpeciesRhodopseudomonas palustris
-
Insert Size (bp)948
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer pCAX-F (CAGCTCCTGGGCAACGTGC)
- 3′ sequencing primer C-CMV-24 (TATTAGGACAAGGCTGGTGGGCAC)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe iRFP insert from pShuttle-CMV-iRFP DNA plasmid (Addgene Plasmid 31856) was used for pAAV-CMV-iRFP.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-iRFP was a gift from Tomomi Ichinose (Addgene plasmid # 64887 ; http://n2t.net/addgene:64887 ; RRID:Addgene_64887) -
For your References section:
Marking cells with infrared fluorescent proteins to preserve photoresponsiveness in the retina. Fyk-Kolodziej B, Hellmer CB, Ichinose T. Biotechniques. 2014 Nov 1;57(5):245-53. doi: 10.2144/000114228. eCollection 2014 Nov. 10.2144/000114228 PubMed 25391913