Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Flag-mLmo2
(Plasmid #64893)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64893 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Prrl-Sin-EF1
  • Total vector size (bp) 7671
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Lmo2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    666
  • Entrez Gene
    Lmo2 (a.k.a. Rbtn-2, Rbtn2, Rhom-2, Ttg2)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pTYF-5 (GTAGACATAATAGCAACAGAC)
  • 3′ sequencing primer SV40 poly A Reverse
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-mLmo2 was a gift from Georges Lacaud (Addgene plasmid # 64893 ; http://n2t.net/addgene:64893 ; RRID:Addgene_64893)
  • For your References section:

    Direct reprogramming of murine fibroblasts to hematopoietic progenitor cells. Batta K, Florkowska M, Kouskoff V, Lacaud G. Cell Rep. 2014 Dec 11;9(5):1871-84. doi: 10.1016/j.celrep.2014.11.002. Epub 2014 Nov 26. 10.1016/j.celrep.2014.11.002 PubMed 25466247