Skip to main content
Addgene

TetO-FUW-NfiB
(Plasmid #64900)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64900 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    TetO-FUW
  • Backbone size w/o insert (bp) 8407
  • Total vector size (bp) 1284
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NfiB
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1558
  • GenBank ID
    18028
  • Entrez Gene
    Nfib (a.k.a. 6720429L07Rik, CTF, E030026I10Rik, NF-I/B, NF1-B, NFI-B)
  • Promoter TetO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site Xba (not destroyed)
  • 5′ sequencing primer GCAGAGCTCGTTTAGTGAACCGTC
  • 3′ sequencing primer AGCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    NfiB coding was amplified from pCHNFI-B2 (#31405)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TetO-FUW-NfiB was a gift from Vania Broccoli (Addgene plasmid # 64900 ; http://n2t.net/addgene:64900 ; RRID:Addgene_64900)
  • For your References section:

    Direct conversion of fibroblasts into functional astrocytes by defined transcription factors. Caiazzo M, Giannelli S, Valente P, Lignani G, Carissimo A, Sessa A, Colasante G, Bartolomeo R, Massimino L, Ferroni S, Settembre C, Benfenati F, Broccoli V. Stem Cell Reports. 2015 Jan 13;4(1):25-36. doi: 10.1016/j.stemcr.2014.12.002. Epub 2014 Dec 31. 10.1016/j.stemcr.2014.12.002 PubMed 25556566