Skip to main content

human syndecan 2 wt
(Plasmid #64970)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64970 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    syndecan 2
  • Species
    H. sapiens (human)
  • Entrez Gene
    SDC2 (a.k.a. CD362, HSPG, HSPG1, SYND2)
  • Promoter CMV

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    human syndecan 2 wt was a gift from Enric Espel (Addgene plasmid # 64970 ; http://n2t.net/addgene:64970 ; RRID:Addgene_64970)
  • For your References section:

    The PDZ-binding domain of syndecan-2 inhibits LFA-1 high-affinity conformation. Rovira-Clave X, Angulo-Ibanez M, Reina M, Espel E. Cell Signal. 2014 Jul;26(7):1489-99. doi: 10.1016/j.cellsig.2014.03.012. Epub 2014 Mar 21. 10.1016/j.cellsig.2014.03.012 PubMed 24662262