Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCRISPReporter-mCherry
(Plasmid #65008)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65008 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCRISPReporter (pETM6/pET-Duet-1)
  • Backbone size w/o insert (bp) 4343
  • Total vector size (bp) 5011
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Species
    Synthetic; Codon-optimized for E. coli expression
  • Insert Size (bp)
    708
  • Promoter User-defined

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GGGCCCGCTGGGAGTTCGTAG
  • 3′ sequencing primer GTCGAGGTGCCGTAAAGCACTAAATCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPReporter-mCherry was a gift from Mattheos Koffas (Addgene plasmid # 65008 ; http://n2t.net/addgene:65008 ; RRID:Addgene_65008)
  • For your References section:

    CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli. Cress BF, Toparlak OD, Guleria S, Lebovich M, Stieglitz JT, Englaender JA, Jones JA, Linhardt RJ, Koffas MA. ACS Synth Biol. 2015 Mar 30. 10.1021/acssynbio.5b00012 PubMed 25822415