-
PurposeExpression of EGFR in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRK5
-
Backbone manufacturerBD PharMingen
- Backbone size w/o insert (bp) 4754
- Total vector size (bp) 8754
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEGFR
-
Alt nameHER1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4000
-
Entrez GeneEGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, NNCIS, PIG61, mENA)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CATACGATTTAGGTGACACTATAG
- 3′ sequencing primer TATAAGCTGCAATAAAC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK5-EGFR was a gift from Axel Ullrich (Addgene plasmid # 65225 ; http://n2t.net/addgene:65225 ; RRID:Addgene_65225)