pLXSN-FLK1 TM
(Plasmid
#65249)
-
PurposeExpression of dominant negative FLK1 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLXSN
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 8300
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFLK1 TM
-
Alt nameVEGFR2 TM; KDR TM
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2400
-
Mutationdeleted AA 786-1346
-
GenBank IDNM_010612
-
Entrez GeneKdr (a.k.a. 6130401C07, Flk-1, Flk1, Krd-1, Ly73, VEGFR-2, VEGFR2, orv, sVEGFR-2)
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer CTCTCCCCCTTGAACCTC
- 3′ sequencing primer GACTTTCCACACCCTAACTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert codes for extracellular and transmembrane domains of FLK1. Note: Amino acid number may be off when compared to current NCBI entry. Please check QC sequence to verify end of coding region.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLXSN-FLK1 TM was a gift from Axel Ullrich (Addgene plasmid # 65249 ; http://n2t.net/addgene:65249 ; RRID:Addgene_65249) -
For your References section:
Glioblastoma growth inhibited in vivo by a dominant-negative Flk-1 mutant. Millauer B, Shawver LK, Plate KH, Risau W, Ullrich A. Nature. 1994 Feb 10;367(6463):576-9. 10.1038/367576a0 PubMed 8107827