pcDNA3-PTK7DN-VSV
(Plasmid
#65251)
-
PurposeExpression of VSV tagged dominant negative PTK7 in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5446
- Total vector size (bp) 7728
-
Modifications to backbonein-frame VSV tag between ApaI and XhoI sites of pcDNA3
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTK7DN
-
Alt nameCCK4DN
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2282
-
Mutationdeleted AA 737-1071
-
GenBank IDNM_002821
-
Entrez GenePTK7 (a.k.a. CCK-4, CCK4)
- Promoter CMV
-
Tag
/ Fusion Protein
- VSV (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CACTGCTTACTGGCTTATCG
- 3′ sequencing primer TGGCAACTAGAAGGCACAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert codes for extracellular and transmembrane domains of PTK7.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-PTK7DN-VSV was a gift from Axel Ullrich (Addgene plasmid # 65251 ; http://n2t.net/addgene:65251 ; RRID:Addgene_65251) -
For your References section:
PTK 7 is a transforming gene and prognostic marker for breast cancer and nodal metastasis involvement. Gartner S, Gunesch A, Knyazeva T, Wolf P, Hogel B, Eiermann W, Ullrich A, Knyazev P, Ataseven B. PLoS One. 2014 Jan 7;9(1):e84472. doi: 10.1371/journal.pone.0084472. eCollection 2014. PONE-D-13-22093 [pii] PubMed 24409301