Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3-PTK7DN-VSV
(Plasmid #65251)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65251 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 7728
  • Modifications to backbone
    in-frame VSV tag between ApaI and XhoI sites of pcDNA3
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PTK7DN
  • Alt name
    CCK4DN
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2282
  • Mutation
    deleted AA 737-1071
  • GenBank ID
    NM_002821
  • Entrez Gene
    PTK7 (a.k.a. CCK-4, CCK4)
  • Promoter CMV
  • Tag / Fusion Protein
    • VSV (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CACTGCTTACTGGCTTATCG
  • 3′ sequencing primer TGGCAACTAGAAGGCACAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert codes for extracellular and transmembrane domains of PTK7.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-PTK7DN-VSV was a gift from Axel Ullrich (Addgene plasmid # 65251 ; http://n2t.net/addgene:65251 ; RRID:Addgene_65251)
  • For your References section:

    PTK 7 is a transforming gene and prognostic marker for breast cancer and nodal metastasis involvement. Gartner S, Gunesch A, Knyazeva T, Wolf P, Hogel B, Eiermann W, Ullrich A, Knyazev P, Ataseven B. PLoS One. 2014 Jan 7;9(1):e84472. doi: 10.1371/journal.pone.0084472. eCollection 2014. PONE-D-13-22093 [pii] PubMed 24409301