Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #65498)


Item Catalog # Description Quantity Price (USD)
Plasmid 65498 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5300
  • Total vector size (bp) 7927
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Tyrosine-protein kinase receptor UFO
  • Alt name
  • Alt name
  • Alt name
    AXL oncogene
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
  • GenBank ID
  • Entrez Gene
    AXL (a.k.a. ARK, JTK11, Tyro7, UFO)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CTGGTCGAGCTGGACGGCGACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    IRES-GFP-AXL-KD was a gift from Aaron Meyer (Addgene plasmid # 65498 ; ; RRID:Addgene_65498)
  • For your References section:

    The AXL Receptor is a Sensor of Ligand Spatial Heterogeneity. Meyer AS, Zweemer AJ, Lauffenburger DA. Cell Syst. 2015 Jul 29;1(1):25-36. 10.1016/j.cels.2015.06.002 PubMed 26236777