Skip to main content

pFLIP37
(Plasmid #65505)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65505 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRSET-B
  • Backbone manufacturer
    Invitrogen
  • Backbone size (bp) 2850
  • Modifications to backbone
    None
  • Vector type
    Bacterial Expression
  • Promoter T7 promoter
  • Tags / Fusion Proteins
    • 6His-Cit-attR1 (N terminal on backbone)
    • attR2-Cer-cMyc (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ACAAGTTTGTACAAAAAAGCA
  • 3′ sequencing primer ACCACTTTGTACAAGAAAGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFLIP37 was a gift from Wolf Frommer (Addgene plasmid # 65505 ; http://n2t.net/addgene:65505 ; RRID:Addgene_65505)
  • For your References section:

    Abscisic acid dynamics in roots detected with genetically encoded FRET sensors. Jones AM, Danielson JA, Manojkumar SN, Lanquar V, Grossmann G, Frommer WB. eLife. 2014 Apr 15;3:e01741. doi: 10.7554/eLife.01741. PubMed 24737862