Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Pflp-18::NGL-1::spGFP11
(Plasmid #65828)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65828 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSM
  • Backbone manufacturer
    C.I. Bargmann and S. MaCarroll
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 9194
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLG-1
  • Alt name
    NLG-1 cDNA
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    2610
  • Mutation
    N142S
  • Entrez Gene
    nlg-1 (a.k.a. CELE_C40C9.5)
  • Promoter Pflp-18
  • Tag / Fusion Protein
    • spGFP11 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer GCCAAAGGACCCAAAGGTATG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Mutation N142S does not affect plasmid function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pflp-18::NGL-1::spGFP11 was a gift from Cori Bargmann & Kang Shen (Addgene plasmid # 65828 ; http://n2t.net/addgene:65828 ; RRID:Addgene_65828)
  • For your References section:

    GFP Reconstitution Across Synaptic Partners (GRASP) defines cell contacts and synapses in living nervous systems. Feinberg EH, Vanhoven MK, Bendesky A, Wang G, Fetter RD, Shen K, Bargmann CI. Neuron. 2008 Feb 7. 57(3):353-63. 10.1016/j.neuron.2007.11.030 PubMed 18255029