-
PurposeFor membrane contact
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65829 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSM
-
Backbone manufacturerC.I. Bargmann and S. MaCarroll
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 8254
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHomo sapiens CD4 molecule (CD4), transcript variant 2, mRNA
-
Alt nameCD4-2 cDNA with artificial introns
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1911
-
GenBank IDNM_001195014
-
Entrez GeneCD4 (a.k.a. CD4mut, IMD79, Leu-3, OKT4D, T4)
- Promoter Prig-3
-
Tag
/ Fusion Protein
- spGFP1-10 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer GCCAAAGGACCCAAAGGTATG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEvan H Feinberg from Bargmann lab made it originally.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Prig-3::CD4::spGFP1-10 was a gift from Cori Bargmann & Kang Shen (Addgene plasmid # 65829 ; http://n2t.net/addgene:65829 ; RRID:Addgene_65829) -
For your References section:
GFP Reconstitution Across Synaptic Partners (GRASP) defines cell contacts and synapses in living nervous systems. Feinberg EH, Vanhoven MK, Bendesky A, Wang G, Fetter RD, Shen K, Bargmann CI. Neuron. 2008 Feb 7. 57(3):353-63. 10.1016/j.neuron.2007.11.030 PubMed 18255029