Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Prig-3::CD4::spGFP1-10
(Plasmid #65829)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65829 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSM
  • Backbone manufacturer
    C.I. Bargmann and S. MaCarroll
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 8254
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Homo sapiens CD4 molecule (CD4), transcript variant 2, mRNA
  • Alt name
    CD4-2 cDNA with artificial introns
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1911
  • GenBank ID
    NM_001195014
  • Entrez Gene
    CD4 (a.k.a. CD4mut, IMD79, Leu-3, OKT4D, T4)
  • Promoter Prig-3
  • Tag / Fusion Protein
    • spGFP1-10 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer GCCAAAGGACCCAAAGGTATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Evan H Feinberg from Bargmann lab made it originally.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Prig-3::CD4::spGFP1-10 was a gift from Cori Bargmann & Kang Shen (Addgene plasmid # 65829 ; http://n2t.net/addgene:65829 ; RRID:Addgene_65829)
  • For your References section:

    GFP Reconstitution Across Synaptic Partners (GRASP) defines cell contacts and synapses in living nervous systems. Feinberg EH, Vanhoven MK, Bendesky A, Wang G, Fetter RD, Shen K, Bargmann CI. Neuron. 2008 Feb 7. 57(3):353-63. 10.1016/j.neuron.2007.11.030 PubMed 18255029