XW21
(Plasmid
#65837)
-
PurposeXW21 Punc-4c-QS-3'UTR-unc-54 (no SL2-mcherry)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSM
-
Backbone manufacturerC.I. Bargmann and S. MaCarroll
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 7299
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNeurospora crassa OR74A repressor (qa-1S)
-
Alt nameQS
-
SpeciesNeurospora crassa
-
Insert Size (bp)2757
-
GenBank IDXM_954524.2
- Promoter Punc-4c
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GCCAAAGGACCCAAAGGTATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
XW21 Punc-4c-QS-3'UTR-unc-54 (no SL2-mcherry)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
XW21 was a gift from Kang Shen (Addgene plasmid # 65837 ; http://n2t.net/addgene:65837 ; RRID:Addgene_65837) -
For your References section:
Controlling gene expression with the Q repressible binary expression system in Caenorhabditis elegans. Wei X, Potter CJ, Luo L, Shen K. Nat Methods. 2012 Mar 11;9(4):391-5. doi: 10.1038/nmeth.1929. 10.1038/nmeth.1929 PubMed 22406855