Skip to main content
Addgene
Open Menu

pcDNA-Dest47- WTN23C11orf83-GFP
(Plasmid #65845)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65845 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 65845-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 65845-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA DEST 47
  • Total vector size (bp) 6252
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Transmembrane (23 AA) of UQCC3
  • Alt name
    C11orf83
  • Species
    H. sapiens (human)
  • Mutation
    WT Transmembrane
  • GenBank ID
    NM_001085372.2
  • Entrez Gene
    UQCC3 (a.k.a. C11orf83, CCDS41658.1, MC3DN9, UNQ655)
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer CACCATGGATTCCTTGCGGAAAATGCTGATCTC
  • 3′ sequencing primer CGCGTAGCCCACGCCAGCCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-Dest47- WTN23C11orf83-GFP was a gift from Amos Bairoch (Addgene plasmid # 65845 ; http://n2t.net/addgene:65845 ; RRID:Addgene_65845)

  • For your References section:

    C11orf83, a mitochondrial cardiolipin-binding protein involved in bc1 complex assembly and supercomplex stabilization. Desmurs M, Foti M, Raemy E, Vaz FM, Martinou JC, Bairoch A, Lane L. Mol Cell Biol. 2015 Apr;35(7):1139-56. doi: 10.1128/MCB.01047-14. Epub 2015 Jan 20. 10.1128/MCB.01047-14 PubMed 25605331
Related items:
Commonly requested with: