-
PurposeChloride-conducting Channelrhodopsin with neuron-specific promoter, plus red fluorescent protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5384
- Total vector size (bp) 7826
-
Modifications to backboneCaMKIIa promoter
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameChannelrhodopsin-2
-
Alt nameChR2, iChloC
-
SpeciesSynthetic; Chlamydomonas
-
Insert Size (bp)927
-
MutationE83Q,E90R,E101S,D156N,T159C
- Promoter CaMKIIa
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CAGGGCAAAGAGGAGCAGG
- 3′ sequencing primer GATTCTCCTCCACGTCACCGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namered fluorescent protein
-
Alt nametDimer 2
-
SpeciesDiscoma sp.
-
Insert Size (bp)1395
- Promoter CaMKIIa
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ggcagaggaagtcttctaacat
- 3′ sequencing primer gtaatccagaggttgattatcg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byChR originally from P.Hegemann, HU-Berlin Germany tDimer originally form R.Tsien USD USA
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV CaMKIIa iChloC 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 66709 ; http://n2t.net/addgene:66709 ; RRID:Addgene_66709) -
For your References section:
An improved chloride-conducting channelrhodopsin for light-induced inhibition of neuronal activity in vivo. Wietek J, Beltramo R, Scanziani M, Hegemann P, Oertner TG, Simon Wiegert J. Sci Rep. 2015 Oct 7;5:14807. doi: 10.1038/srep14807. 10.1038/srep14807 PubMed 26443033