Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV EF1a DIO iChloC 2A dsRed
(Plasmid #70762)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70762 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5601
  • Total vector size (bp) 8007
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Channelrhodopsin-2
  • Alt name
    ChR2, iChloC
  • Species
    Synthetic; Chlamydomonas
  • Insert Size (bp)
    927
  • Mutation
    E83Q,E90R,E101S,D156N,T159C
  • Promoter EF1a

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GGGATTCTCCTCCACGTCACCGC
  • 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
    dsRed
  • Species
    Discoma sp.
  • Promoter EF1a

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gagtttggatcttggttc
  • 3′ sequencing primer GGCAGAGGAAGTCTTCTAACAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ChR originally from P.Hegemann, HU-Berlin Germany tDimer originally form R.Tsien USD USA
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV EF1a DIO iChloC 2A dsRed was a gift from Thomas Oertner (Addgene plasmid # 70762 ; http://n2t.net/addgene:70762 ; RRID:Addgene_70762)
  • For your References section:

    An improved chloride-conducting channelrhodopsin for light-induced inhibition of neuronal activity in vivo. Wietek J, Beltramo R, Scanziani M, Hegemann P, Oertner TG, Simon Wiegert J. Sci Rep. 2015 Oct 7;5:14807. doi: 10.1038/srep14807. 10.1038/srep14807 PubMed 26443033