-
PurposeAn improved chloride-conducting channelrhodopsin for light-induced inhibition of neuronal activity in vivo. Cre inducible expression (double floxed inversed ORF)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5601
- Total vector size (bp) 8007
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameChannelrhodopsin-2
-
Alt nameChR2, iChloC
-
SpeciesSynthetic; Chlamydomonas
-
Insert Size (bp)927
-
MutationE83Q,E90R,E101S,D156N,T159C
- Promoter EF1a
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GGGATTCTCCTCCACGTCACCGC
- 3′ sequencing primer GTAATCCAGAGGTTGATTATCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namered fluorescent protein
-
Alt namedsRed
-
SpeciesDiscoma sp.
- Promoter EF1a
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gagtttggatcttggttc
- 3′ sequencing primer GGCAGAGGAAGTCTTCTAACAT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byChR originally from P.Hegemann, HU-Berlin Germany tDimer originally form R.Tsien USD USA
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV EF1a DIO iChloC 2A dsRed was a gift from Thomas Oertner (Addgene plasmid # 70762 ; http://n2t.net/addgene:70762 ; RRID:Addgene_70762) -
For your References section:
An improved chloride-conducting channelrhodopsin for light-induced inhibition of neuronal activity in vivo. Wietek J, Beltramo R, Scanziani M, Hegemann P, Oertner TG, Simon Wiegert J. Sci Rep. 2015 Oct 7;5:14807. doi: 10.1038/srep14807. 10.1038/srep14807 PubMed 26443033