-
PurposeExpression of murine PDGFRalpha tagged with GFP under the control of EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66787 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA5FRT
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePDGFRalpha
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4049
-
GenBank IDNM_001083316.1
-
Entrez GenePdgfra (a.k.a. CD140a, Pdgfr-2)
- Promoter EF1a
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer EF-1a-F (TCAAGCCTCAGACAGTGGTTC)
- 3′ sequencing primer BGH-rev (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5FRT-EF-Pdgfralpha-EGFPN was a gift from Lotte Pedersen (Addgene plasmid # 66787 ; http://n2t.net/addgene:66787 ; RRID:Addgene_66787) -
For your References section:
PDGFRbeta and oncogenic mutant PDGFRalpha D842V promote disassembly of primary cilia through a PLCgamma- and AURKA-dependent mechanism. Nielsen BS, Malinda RR, Schmid FM, Pedersen SF, Christensen ST, Pedersen LB. J Cell Sci. 2015 Oct 1;128(19):3543-9. doi: 10.1242/jcs.173559. Epub 2015 Aug 19. 10.1242/jcs.173559 PubMed 26290382