Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

4XCLEAR-luciferase reporter
(Plasmid #66800)


Item Catalog # Description Quantity Price (USD)
Plasmid 66800 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin (50 ug/mL)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Promoter Four CLEAR elements (GTCACGTGAC) in tandem derived from LAMP-1 promoter + HTK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer RVprimer3 (CTAGCAAAATAGGCTGTCCC)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    4XCLEAR-luciferase reporter was a gift from Albert La Spada (Addgene plasmid # 66800 ; ; RRID:Addgene_66800)
  • For your References section:

    Polyglutamine-expanded androgen receptor interferes with TFEB to elicit autophagy defects in SBMA. Cortes CJ, Miranda HC, Frankowski H, Batlevi Y, Young JE, Le A, Ivanov N, Sopher BL, Carromeu C, Muotri AR, Garden GA, La Spada AR. Nat Neurosci. 2014 Sep;17(9):1180-9. doi: 10.1038/nn.3787. Epub 2014 Aug 10. 10.1038/nn.3787 PubMed 25108912