-
PurposeReporter for activity of the CLEAR network
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66800 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin (50 ug/mL)
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name4XCLEAR
-
SpeciesM. musculus (mouse)
- Promoter Four CLEAR elements (GTCACGTGAC) in tandem derived from LAMP-1 promoter + HTK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer RVprimer3 (CTAGCAAAATAGGCTGTCCC) (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
4XCLEAR-luciferase reporter was a gift from Albert La Spada (Addgene plasmid # 66800 ; http://n2t.net/addgene:66800 ; RRID:Addgene_66800) -
For your References section:
Polyglutamine-expanded androgen receptor interferes with TFEB to elicit autophagy defects in SBMA. Cortes CJ, Miranda HC, Frankowski H, Batlevi Y, Young JE, Le A, Ivanov N, Sopher BL, Carromeu C, Muotri AR, Garden GA, La Spada AR. Nat Neurosci. 2014 Sep;17(9):1180-9. doi: 10.1038/nn.3787. Epub 2014 Aug 10. 10.1038/nn.3787 PubMed 25108912