-
PurposeGFP^SEC^3xFlag vector with ccdB markers for cloning homology arms
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66823 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19 (modified)
- Backbone size w/o insert (bp) 2600
- Total vector size (bp) 10500
-
Modifications to backboneAddition of ccdB markers to facilitate homology arm cloning
-
Vector typeWorm Expression, Cre/Lox, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Turbo
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP-C1^SEC^3xFlag
-
SpeciesC. elegans (nematode), Synthetic
-
Insert Size (bp)6600
-
Tags
/ Fusion Proteins
- C. elegans codon-optimized GFP
- 3xFlag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
- 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.
Sequence note: The full sequence is based on Addgene NGS of our stock. There may be some slight but innocuous inconsistencies with the depositor's GenBank files. One discrepancy affects the sequence of the 3' arm reverse primer (Table P1 and Figure P1) from the associated publication. The first g from the 3' end is missing:[tcacacaggaaacagctatgaccatgttat] -> [tcacacaggaaacagctatgaccatttat]
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDD282 was a gift from Bob Goldstein (Addgene plasmid # 66823 ; http://n2t.net/addgene:66823 ; RRID:Addgene_66823) -
For your References section:
Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. Genetics. 2015 Jun 3. pii: genetics.115.178335. 10.1534/genetics.115.178335 PubMed 26044593