Skip to main content

pAAV-Ef1a-DIO-OMOR-eYFP
(Plasmid #66847)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66847 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 6330
  • Total vector size (bp) 7448
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Opto Mu opioid receptor
  • Alt name
    OMOR
  • Alt name
    Opto-MOR
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1118
  • Promoter Ef1a
  • Tag / Fusion Protein
    • eYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer gcttatcgataatcaacctctgg
  • 3′ sequencing primer GGT GAA CAG CTC CTC GCC CTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO-OMOR-eYFP was a gift from Michael Bruchas (Addgene plasmid # 66847 ; http://n2t.net/addgene:66847 ; RRID:Addgene_66847)
  • For your References section:

    Spatiotemporal control of opioid signaling and behavior. Siuda ER, Copits BA, Schmidt MJ, Baird MA, Al-Hasani R, Planer WJ, Funderburk SC, McCall JG, Gereau RW 4th, Bruchas MR. Neuron. 2015 May 20;86(4):923-35. doi: 10.1016/j.neuron.2015.03.066. Epub 2015 Apr 30. 10.1016/j.neuron.2015.03.066 PubMed 25937173