pGL3-LRR
(Plasmid
#66937)
-
Purpose(Empty Backbone) Destination vector; gateway cassette cloned upstream of basal promoter driving luciferase. Reverse orientation (attR2, attR1).
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66937 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL3
-
Backbone manufacturerPromega
- Backbone size (bp) 5010
-
Modifications to backboneInserted the cassette contains the chloramphenicol resistance gene and the ccdB gene flanked by attR1 and attR2 sites.
-
Vector typeMammalian Expression, Luciferase
- Promoter SV-40
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CCTCGGCCTCTGCATAAATA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-LRR was a gift from Alvaro Monteiro (Addgene plasmid # 66937 ; http://n2t.net/addgene:66937 ; RRID:Addgene_66937) -
For your References section:
Enhancer scanning to locate regulatory regions in genomic loci. Buckley M, Gjyshi A, Mendoza-Fandino G, Baskin R, Carvalho RS, Carvalho MA, Woods NT, Monteiro AN. Nat Protoc. 2016 Jan;11(1):46-60. doi: 10.1038/nprot.2015.136. Epub 2015 Dec 10. 10.1038/nprot.2015.136 PubMed 26658467