Skip to main content

pCAS9-mCherry-Frame +2
(Plasmid #66941)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66941 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAS9-mCherry
  • Backbone manufacturer
    Hornung Lab

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA frame +2
  • gRNA/shRNA sequence
    GGGCCAGTACCCAAAAAGCG

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

please check ip situation
sequence with: tacgatacaaggctgttagagag

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAS9-mCherry-Frame +2 was a gift from Veit Hornung (Addgene plasmid # 66941 ; http://n2t.net/addgene:66941 ; RRID:Addgene_66941)
  • For your References section:

    CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Schmid-Burgk JL, Honing K, Ebert TS, Hornung V. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. 10.1038/ncomms12338 PubMed 27465542